View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_high_45 (Length: 249)
Name: NF14492_high_45
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_high_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 26838720 - 26838577
Alignment:
| Q |
1 |
cacacatgttgtgaggacttggtcatccttttgagtgtgtttaaatctatggcgttagagtagactctactgcaaccatgctaaattatataggttcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
26838720 |
cacacatgttgtgaggacttggtcatccttttgagtgtgtttaaatctatggcgttggagtagactctaatgcaaccatgctaaaatatataggttcaaa |
26838621 |
T |
|
| Q |
101 |
aacacatgaaaaatgatggctcctaacgattacgatgagcggaa |
144 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||| |||||||||| |
|
|
| T |
26838620 |
aacacatgaaaaatgatggctcataaggattacaatgagcggaa |
26838577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 141 - 227
Target Start/End: Complemental strand, 26837554 - 26837468
Alignment:
| Q |
141 |
ggaatgtatttgctgtcatataagttactggtgtgttgaaggtaaatgggcaattgtcatggtaagtcatcttaatgtttatttggg |
227 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||| |||||||||| | |||||||||| ||||||||| |
|
|
| T |
26837554 |
ggaatgtatttgccgtcatataagttactgatgtgttgaaggtaaatgggcaactgtcatggtatggcatcttaatggttatttggg |
26837468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 50973822 - 50973679
Alignment:
| Q |
1 |
cacacatgttgtgaggacttggtcatccttttgagtgtgtttaaatctatggcgttagagtagactctactgcaaccatgctaaattatataggttcaaa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
50973822 |
cacatatgttgtgaggacttggtcatccttttgagtgtgtttaaatctatggcgttggagcagactctaatgcaaccatgctaaaatatataggttcaaa |
50973723 |
T |
|
| Q |
101 |
aacacatgaaaaatgatggctcctaacgattacgatgagcggaa |
144 |
Q |
| |
|
|||||||||| ||||||||||| ||| |||||| ||||||||| |
|
|
| T |
50973722 |
aacacatgaacaatgatggctcataaggattacagtgagcggaa |
50973679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University