View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_high_47 (Length: 238)
Name: NF14492_high_47
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_high_47 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 22 - 238
Target Start/End: Original strand, 27448430 - 27448645
Alignment:
| Q |
22 |
ttgactccaacttttctttgattcatgctttttctctagcacatggtgatgctgttgcttcaacacaatactctctatccttcaaggtaaaaaacattct |
121 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27448430 |
ttgactcaaacttttctttgattcatgctttttcattagcgcatggtgatgctgttgcttcaacacaatactctctatccttcaaggtaaaaaacattct |
27448529 |
T |
|
| Q |
122 |
atgctttgtttacttctaaggaaatatctaaaaataatcgattggttatttttgtgatggcagagaaatctaagagatgttgctgcgttgtatggatgcg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27448530 |
atgctttgtttacttctaaggaaatatctaaaaa-aattgattggttatttttgtgatggcagagaaatctaagagatgttgctgagttgtatggatgcg |
27448628 |
T |
|
| Q |
222 |
agccaactttggaagct |
238 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
27448629 |
agccaactttggaagct |
27448645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 27 - 109
Target Start/End: Original strand, 27423172 - 27423254
Alignment:
| Q |
27 |
tccaacttttctttgattcatgctttttctctagcacatggtgatgctgttgcttcaacacaatactctctatccttcaaggt |
109 |
Q |
| |
|
|||||||| |||| |||||| | |||||| |||||||||||||||| ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
27423172 |
tccaacttgccttttattcattccttttctgaagcacatggtgatgctcttgcttcttcacaacactctctatccttcaaggt |
27423254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 109
Target Start/End: Original strand, 27401088 - 27401155
Alignment:
| Q |
42 |
attcatgctttttctctagcacatggtgatgctgttgcttcaacacaatactctctatccttcaaggt |
109 |
Q |
| |
|
|||||||| |||||| ||| || ||||||||| ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
27401088 |
attcatgccttttctgaagctcaaggtgatgctcttgcttcttcacaacactctctatccttcaaggt |
27401155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University