View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_high_56 (Length: 206)
Name: NF14492_high_56
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_high_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 11 - 98
Target Start/End: Complemental strand, 24400222 - 24400135
Alignment:
| Q |
11 |
cacagacatatcttagggaactggataagttttgtatcgatgaccgatgggacaaaaacaagtcaatgcatatggttatgtcattgtt |
98 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24400222 |
cacacacatatcttagggaactggataagttttgtatcgatggccgatgggacaaaaacaagtcaatgcatatggttatgtcattgtt |
24400135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 188
Target Start/End: Complemental strand, 24400139 - 24400106
Alignment:
| Q |
155 |
ttgttcggcttgtgtattatctattatcaataat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
24400139 |
ttgttcggcttgtgtattatctattatcaataat |
24400106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University