View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_high_6 (Length: 506)
Name: NF14492_high_6
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 480; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 480; E-Value: 0
Query Start/End: Original strand, 1 - 488
Target Start/End: Complemental strand, 46599424 - 46598937
Alignment:
| Q |
1 |
agtgcagaagaagacagaattttaacacgactggttgaacaacatggagcaagaaactggtcactcatcagccgctacataaaaggtcgttccggcaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599424 |
agtgcagaagaagacagaattttaacacgactggttgaacaacatggagcaagaaactggtcactcatcagccgctacataaaaggtcgttccggcaagt |
46599325 |
T |
|
| Q |
101 |
catgtcgtctccggtggtgtaatcagctgagtcccaccgtggaacaccgtccattttcttcacaagaagatgaaacaatcatagcggcgcatgctcaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599324 |
catgtcgtctccggtggtgtaatcagctgagtcccaccgtggaacaccgtccattttcttcacaagaagatgaaacaatcatagcggcgcatgctcaata |
46599225 |
T |
|
| Q |
201 |
tggtaaccgttgggctaccattgcaaggcttttacctggtagaactgataatgctgtcaagaatcattggaactctacgcttaagcgtagagcgggttgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599224 |
tggtaaccgttgggctaccattgcaaggcttttacctggtagaactgataatgctgtcaagaatcattggaactctacgcttaagcgtagagcgggttgt |
46599125 |
T |
|
| Q |
301 |
ggtggttctgttacggttgctggaggtggcaacgaaggtggtcagtttacttttccggtggaagatgatccgttgactgcgttgactcttgctcctccgg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46599124 |
ggtggttctgttacggttgctggaggtggcaacgaaggtggtcagtttacttttccgttggaagatgatccgttgaccgcgttgactcttgctcctccgg |
46599025 |
T |
|
| Q |
401 |
ggaatggtgtggaagatagggaggaaatggttggtgatcatcggtttccttcgccggaaaatgttccgactgagttttgggatgtgat |
488 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599024 |
ggaatggtgtggaagatagggaggaaatggttggtgatcatcggtttccttcgccggaaaatgttccgactgagttttgggatgtgat |
46598937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 40752055 - 40752008
Alignment:
| Q |
223 |
gcaaggcttttacctggtagaactgataatgctgtcaagaatcattgg |
270 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40752055 |
gcaagacttttccctggtagaactgataatgctgtgaagaatcattgg |
40752008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 85 - 140
Target Start/End: Original strand, 35747986 - 35748041
Alignment:
| Q |
85 |
ggtcgttccggcaagtcatgtcgtctccggtggtgtaatcagctgagtcccaccgt |
140 |
Q |
| |
|
|||||||| || || ||||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
35747986 |
ggtcgttcaggaaaatcatgccgtctacggtggtgtaatcagctgagtccaaccgt |
35748041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 220 - 266
Target Start/End: Complemental strand, 31791067 - 31791021
Alignment:
| Q |
220 |
attgcaaggcttttacctggtagaactgataatgctgtcaagaatca |
266 |
Q |
| |
|
||||| |||||||| ||||| ||||||||||||||||| |||||||| |
|
|
| T |
31791067 |
attgctaggcttttccctggaagaactgataatgctgttaagaatca |
31791021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University