View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_low_28 (Length: 317)
Name: NF14492_low_28
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 87 - 246
Target Start/End: Complemental strand, 1411185 - 1411027
Alignment:
| Q |
87 |
aggcttctgaatctacctacccttcttttctgagtgctttgtgttcatcaagttcaggaattcaattatttgaagttgaagcttgaaagttgaaaaccct |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||| | |
|
|
| T |
1411185 |
aggcttctgaatctacctacccttcttttctgagtgctttgtgttcatcaagttcaggaattcaattatttgaagttgaaagttgaaaattg-aaaccat |
1411087 |
T |
|
| Q |
187 |
tttcctttatttaactgtttatgttgtatgttatatgtagcatcgacactccagattaaa |
246 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1411086 |
tgtcctttatttaactgtttatgttgtatgttatatgtagcatcgacgctccagattaaa |
1411027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 53
Target Start/End: Complemental strand, 1411253 - 1411220
Alignment:
| Q |
20 |
tgttttgttagttaaaattctgttaaggtagtta |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1411253 |
tgttttgttagttaaaattctgttaaggtagtta |
1411220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University