View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_low_39 (Length: 271)
Name: NF14492_low_39
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 15 - 254
Target Start/End: Original strand, 43729925 - 43730164
Alignment:
| Q |
15 |
aaaatatatttaaaagtaaagaaaaatgccttaattgtcttgacgggaggcttgttgattttcttcaaatgagctctgattctcttcaatttatgcaatg |
114 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43729925 |
aaaaaatatttaaaggtaaagaaaaatgccttaattgtcttgacgggaagcttgttgattttcttcaaatgagctctgattctcttcaatttatgcaatg |
43730024 |
T |
 |
| Q |
115 |
caacatctggtctaaaagtttggttagccttggagtgagattgtacttgtgatgaagttgaatttgagacaatggggtgtgacaaaattggactaattga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43730025 |
caacatctggtctaaaagtttggttagccttggagtgagattgtacttgtgatgaagttgaatttgagacaatggggtgtgacaaaattggactaattga |
43730124 |
T |
 |
| Q |
215 |
ggtaaaaaacagaagcaaagtaacaaaaagatgtagaata |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43730125 |
ggtaaaaaacagaagcaaagtaacaaaaagatgtagaata |
43730164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University