View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_low_40 (Length: 270)
Name: NF14492_low_40
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_low_40 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 10 - 270
Target Start/End: Complemental strand, 34348658 - 34348403
Alignment:
| Q |
10 |
aggagcacagaagaaaagtcgcatcaagtaagaaacaagagtcatttaaattataaagtatactagtatatgtatgaatctgtttatgtgctttaattta |
109 |
Q |
| |
|
|||| |||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34348658 |
aggaccacaaaagaaaagtcgcatgaagtaagaaacaagagtcatttaaattataaagtatactagtatatgtatgaatctgtttatgtgcttta----- |
34348564 |
T |
 |
| Q |
110 |
ctgtgatgtggactgcaattcttgcactcaaccagaccaaatacttttaaatagaatcacttttctatgcctcgtggattccaaccatggaagacataaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34348563 |
ctgtgatgtggactgcaattcttgcactcaaccagaccaaatgcttttaaataggatcacttttctatgcctcgtggattccaaccatgcaagacataaa |
34348464 |
T |
 |
| Q |
210 |
atgggagcatatggtttaatttgagcttttgaggggaccatcaaccatatttttcatttct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34348463 |
atgggagcatatggtttaatttgagcttttgaggggaccatcaaccatatttttcatttct |
34348403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University