View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_low_43 (Length: 265)
Name: NF14492_low_43
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_low_43 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 265
Target Start/End: Complemental strand, 3884461 - 3884214
Alignment:
| Q |
18 |
atcaatcacatgatggaagaagggcttacctgatagccaccaataactaagaggttacaatatcccggatgaaatatgcacgattgaaacttgttcccgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884461 |
atcaatcacatgatggaagaagggcttacctgatagccaccaataactaagaggttacaatatcccggatgaaatatgcacgattgaaacttgttcccgt |
3884362 |
T |
|
| Q |
118 |
ttgaatgcaactcgccgatgcattctccgtccgaccagactcgtgcacaatcttcactgacagaggcaatatactttcccgttctatcccaacaaatgga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884361 |
ttgaatgcaactcgccgatgcattctccgttcgaccagactcgtgcacaatcttcactgacagaggcaatatactttcccgttctatcccaacaaatgga |
3884262 |
T |
|
| Q |
218 |
aagaacatctttatcatgtccctaaaatgaaacaaaattcagttatga |
265 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3884261 |
aagaacatctttatcatgtccctaaaaggaaacaaaattcagttatga |
3884214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 187
Target Start/End: Original strand, 35240794 - 35240846
Alignment:
| Q |
135 |
atgcattctccgtccgaccagactcgtgcacaatcttcactgacagaggcaat |
187 |
Q |
| |
|
||||||| ||||||||||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
35240794 |
atgcattgtccgtccgaccagacacgtacatcatcttcactgacagaggcaat |
35240846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Original strand, 35237790 - 35237828
Alignment:
| Q |
149 |
cgaccagactcgtgcacaatcttcactgacagaggcaat |
187 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
35237790 |
cgaccagacacgtgcacaatcttcagtgacagaggcaat |
35237828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University