View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_low_45 (Length: 254)
Name: NF14492_low_45
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 6 - 222
Target Start/End: Complemental strand, 500310 - 500094
Alignment:
| Q |
6 |
caaaggtcgttctatttcaactcaacttcttcgcgcaattcgacaatcacgtgtttctattattattttctcaaaagattatgcttcatccacatggtgt |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
500310 |
caaaggtcattctatttcaactcaacttcttcatgcaattcgacaatcacgtgtttctattattattttctcaaaagattatgcttcatcaacatggtgt |
500211 |
T |
 |
| Q |
106 |
ttggatgaaatggctacaattgctgattgccggttaaatttgaaacaaactgttttctatgatgttgctccgtctgatgtacgaaaacagaaaggttttt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
500210 |
ttggatgaaatggctacaattgctgattgccagttaaatttgaatcacactgttttctatgatgttgctccgtctgatgtgcgaaaacagaaaggtgttt |
500111 |
T |
 |
| Q |
206 |
atcaggatgcctttgct |
222 |
Q |
| |
|
||||| ||| ||||||| |
|
|
| T |
500110 |
atcagaatgtctttgct |
500094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 25436432 - 25436331
Alignment:
| Q |
19 |
atttcaactcaacttcttcgcgcaattcgacaatcacgtgtttctattattattttctcaaaagattatgcttcatccacatggtgtttggatgaaatgg |
118 |
Q |
| |
|
|||||| | |||||||| | |||||||||| ||||| |||| ||| ||| ||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25436432 |
atttcaccccaacttctacaagcaattcgacggtcacgggtttgtatcattgttttctcaagagattatgcttcatcaacatggtgtttggatgaaatgg |
25436333 |
T |
 |
| Q |
119 |
ct |
120 |
Q |
| |
|
|| |
|
|
| T |
25436332 |
ct |
25436331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 58 - 120
Target Start/End: Original strand, 25442495 - 25442557
Alignment:
| Q |
58 |
gtttctattattattttctcaaaagattatgcttcatccacatggtgtttggatgaaatggct |
120 |
Q |
| |
|
|||||||| ||| | ||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25442495 |
gtttctatcattgtcttctccaaagattatgcttcatcaacatggtgtttggatgaaatggct |
25442557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 58 - 120
Target Start/End: Original strand, 25636687 - 25636749
Alignment:
| Q |
58 |
gtttctattattattttctcaaaagattatgcttcatccacatggtgtttggatgaaatggct |
120 |
Q |
| |
|
|||||||| ||| | ||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25636687 |
gtttctatcattgtcttctccaaagattatgcttcatcaacatggtgtttggatgaaatggct |
25636749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 120
Target Start/End: Original strand, 25484407 - 25484508
Alignment:
| Q |
19 |
atttcaactcaacttcttcgcgcaattcgacaatcacgtgtttctattattattttctcaaaagattatgcttcatccacatggtgtttggatgaaatgg |
118 |
Q |
| |
|
|||||| | |||||||| | ||||||| ||| ||||| ||||||| || ||||||| |||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
25484407 |
atttcaccccaacttctacaagcaattcaacagtcacgcatttctatcgttgttttctccaaagattatgcttcttcaacatggtgtttggatgaaatgg |
25484506 |
T |
 |
| Q |
119 |
ct |
120 |
Q |
| |
|
|| |
|
|
| T |
25484507 |
ct |
25484508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University