View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_low_46 (Length: 249)
Name: NF14492_low_46
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 231
Target Start/End: Original strand, 50427865 - 50428080
Alignment:
| Q |
16 |
atcaaaccaacatgctcttctacattcacgaccacttcaccggtgaaaacacgtcggcagtcaccgttgccggtataaatggacccaactttaatatcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50427865 |
atcaaaccaacatgctcttctacattcacgaccacttcaccggtgaaaacacgtcggcagtcaccgttgccggtataaatggacccaactttaatatcca |
50427964 |
T |
|
| Q |
116 |
acacttcggcaccgtggcaataattgatgatccagtaacagagggacccgcaatggattcaacactccttggcagtgctcagggcgtgtacgtaaattcg |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50427965 |
acacttcggcaccgtggcaataatcgatgatccagtaacagagggacccgcaatggattcaacactccttggcagtgctcagggcgtgtacgtaaattcg |
50428064 |
T |
|
| Q |
216 |
cagcttgatagcaaag |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
50428065 |
cagcttgatagcaaag |
50428080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 111 - 224
Target Start/End: Original strand, 50422787 - 50422900
Alignment:
| Q |
111 |
atccaacacttcggcaccgtggcaataattgatgatccagtaacagagggacccgcaatggattcaacactccttggcagtgctcagggcgtgtacgtaa |
210 |
Q |
| |
|
|||| |||||| |||||||| || ||| |||| ||||||||||| |||||||| |||||||||||| |||| | || || ||||| ||| |||| ||| |
|
|
| T |
50422787 |
atcctacactttggcaccgtagctatagttgacgatccagtaaccgagggacctacaatggattcaaaactcatcggtagagctcaaggcacgtacataa |
50422886 |
T |
|
| Q |
211 |
attcgcagcttgat |
224 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
50422887 |
attcgcagcttgat |
50422900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University