View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_low_50 (Length: 237)
Name: NF14492_low_50
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 29515020 - 29514798
Alignment:
| Q |
1 |
aaatagtcactccaattcttctcttctcatctcaatctgtctctctcacctaactactctcaacaaagtaaggagaaatgaccctatcgacttgtacagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29515020 |
aaatagtcactccaattcttctcttctcttctcattctgtctctctcacctaactactctcaacaaagtaaggagaaatgaccctatcgacttgtacagc |
29514921 |
T |
|
| Q |
101 |
cgtccttagctgtgggactgaaataaatgatcatattggccaaggaatcacagttggaaacatgatatgtcggtcggtatttattaatgatgtccaacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||||||||||||||||||| | |
|
|
| T |
29514920 |
cgtccttagctgtgggactgaaataaatgatcatattggccaaggaatcacagttggagatatgatatgt----cggtatttattaatgatgtccaacta |
29514825 |
T |
|
| Q |
201 |
ctatagcctattgacctggtattcatt |
227 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
29514824 |
ctatagcatattgacctggtattcatt |
29514798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University