View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14492_low_54 (Length: 228)

Name: NF14492_low_54
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14492_low_54
NF14492_low_54
[»] chr2 (1 HSPs)
chr2 (1-168)||(43540236-43540403)


Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 43540403 - 43540236
Alignment:
1 gttttcacctcctctattgataaagcttcaacctttttggttgaagcctttctgggtgctcgnnnnnnnccagcggcagcgacggcagtggcggcttggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||    
43540403 gttttcacctcctctattgataaagcttcaacctttttggttgaagcctttctgggtgctcgtttttttccagcggcagcgacggcagtggcggcttggg 43540304  T
101 gaagtgaagcggagataacagtgagggttacagtgaatttgaggaaattgaggttgttaaagttgaga 168  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43540303 gaagtgacgcggagataacagtgagggttacagtgaatttgaggaaattgaggttgttaaagttgaga 43540236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University