View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_low_55 (Length: 228)
Name: NF14492_low_55
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_low_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 123 - 210
Target Start/End: Complemental strand, 44476374 - 44476290
Alignment:
| Q |
123 |
agaacagagatgatactaaaatttgttatattaaaaatattcttctagttctatgcaattaactaaaattagtgtccatatgtgtagt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44476374 |
agaacagagatgatactaaaatttgttatattaaaaatattct---agttctatgcaattaactaaaattagtgtccatatgtgtagt |
44476290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 17 - 125
Target Start/End: Complemental strand, 44476629 - 44476521
Alignment:
| Q |
17 |
aatatccaaaactcatttctgactaatgtatggtccgaccaannnnnnnngttaaacaagtataattagttgtattttcttgatgaaggtatagcacgat |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44476629 |
aatatccaaaactcgtttctgactaatgtatggtccgaccaattttttttgttaaacaagtataattagttgtatttttttgatgaaggtatagcacgat |
44476530 |
T |
|
| Q |
117 |
acgagaaga |
125 |
Q |
| |
|
||||||| |
|
|
| T |
44476529 |
gtgagaaga |
44476521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 134 - 205
Target Start/End: Complemental strand, 44471777 - 44471710
Alignment:
| Q |
134 |
gatactaaaatttgttatattaaaaatattcttctagttctatgcaattaactaaaattagtgtccatatgt |
205 |
Q |
| |
|
||||||| ||||||||||||||||| | || |||||||||||||||||||||||||||| || |||||| |
|
|
| T |
44471777 |
gatactagaatttgttatattaaaa----tattatagttctatgcaattaactaaaattagtctctatatgt |
44471710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University