View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_low_57 (Length: 215)
Name: NF14492_low_57
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 24400217 - 24400421
Alignment:
| Q |
1 |
tgtgtgttgcgtattaacttcaatttaatgaaatatggcctagtttgcatttattattgttaactcgggattttcaatcgtatgcagcaaacctcagctt |
100 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24400217 |
tgtgtgttgagtattaacttcaatttcatgaaatgcggcctagtttgtatttattattgttaactcgggattttcaatcgtatgcagcaaacctcagctt |
24400316 |
T |
 |
| Q |
101 |
ccattgagttataggctttgatttcaagatgaatggaagaaactctcaccaagtatcagacagtgcttctggtacttatgatgattctgatatttatgat |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24400317 |
ccattgagctataggctttgatttcaagatgaatggaagaaactctcaccaagtatcagacagtgcttctggtacttatgatgattctgatatttatgat |
24400416 |
T |
 |
| Q |
201 |
gatga |
205 |
Q |
| |
|
||||| |
|
|
| T |
24400417 |
gatga |
24400421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University