View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14492_low_58 (Length: 206)

Name: NF14492_low_58
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14492_low_58
NF14492_low_58
[»] chr3 (2 HSPs)
chr3 (11-98)||(24400135-24400222)
chr3 (155-188)||(24400106-24400139)


Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 11 - 98
Target Start/End: Complemental strand, 24400222 - 24400135
Alignment:
11 cacagacatatcttagggaactggataagttttgtatcgatgaccgatgggacaaaaacaagtcaatgcatatggttatgtcattgtt 98  Q
    |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
24400222 cacacacatatcttagggaactggataagttttgtatcgatggccgatgggacaaaaacaagtcaatgcatatggttatgtcattgtt 24400135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 188
Target Start/End: Complemental strand, 24400139 - 24400106
Alignment:
155 ttgttcggcttgtgtattatctattatcaataat 188  Q
    ||||||||||||||||||||||||||||||||||    
24400139 ttgttcggcttgtgtattatctattatcaataat 24400106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University