View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14492_low_59 (Length: 204)

Name: NF14492_low_59
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14492_low_59
NF14492_low_59
[»] chr1 (1 HSPs)
chr1 (13-193)||(5508711-5508890)


Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 13 - 193
Target Start/End: Complemental strand, 5508890 - 5508711
Alignment:
13 gataatactattttgcaataaaactcaatggataggtagacttggagaaatgttttaaatggtgannnnnnnagtcaaagagaattaccaactgttgaag 112  Q
    ||||||| |||||||| |||||||||| ||||||||||||||||||||||||||| |||||||||       |||||||||| |||||||||||||||||    
5508890 gataatattattttgcgataaaactcattggataggtagacttggagaaatgtttcaaatggtgatttttt-agtcaaagaggattaccaactgttgaag 5508792  T
113 tggaatccaacattaaaaggttgcctttgtatgaaataaaatagttttgttgaatgtttcttgcttttgtggaggttactg 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
5508791 tggaatccaacattaaaaggttgcctttgtatgaaataaaatagttttgttgaatgtttctcgcttttgtggaggttactg 5508711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University