View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_low_59 (Length: 204)
Name: NF14492_low_59
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_low_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 13 - 193
Target Start/End: Complemental strand, 5508890 - 5508711
Alignment:
| Q |
13 |
gataatactattttgcaataaaactcaatggataggtagacttggagaaatgttttaaatggtgannnnnnnagtcaaagagaattaccaactgttgaag |
112 |
Q |
| |
|
||||||| |||||||| |||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
5508890 |
gataatattattttgcgataaaactcattggataggtagacttggagaaatgtttcaaatggtgatttttt-agtcaaagaggattaccaactgttgaag |
5508792 |
T |
|
| Q |
113 |
tggaatccaacattaaaaggttgcctttgtatgaaataaaatagttttgttgaatgtttcttgcttttgtggaggttactg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5508791 |
tggaatccaacattaaaaggttgcctttgtatgaaataaaatagttttgttgaatgtttctcgcttttgtggaggttactg |
5508711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University