View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_low_9 (Length: 489)
Name: NF14492_low_9
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 14 - 355
Target Start/End: Original strand, 46543660 - 46544001
Alignment:
| Q |
14 |
ccctctgcccattacattgcaccaaatcatctctcccaccttattattcaacaaagtttggtttggtttctgaaaaagagacaatgttaagaagtgacca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46543660 |
ccctctgcccattacattgcaccaaatcatctctcccaccttattattcaacaaagtttggtttggtttctgaaaaagagacaatgttaagaagtgacca |
46543759 |
T |
 |
| Q |
114 |
ttgatttgatagtgttttcggtgttgcgactgaaactgggaaacaaagaaagtgataaatgagtcttcatcaatttggttcttatttgactcacatcttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46543760 |
ttgatttgatagtgttttcggtgttgcgactgaaactgggaaacaaagaaagtgataaatgagtcttcatcaatttggttcttaattgactcacatcttt |
46543859 |
T |
 |
| Q |
214 |
attcccatccatcaaacacnnnnnnnnnnnnnnnnnnnnnnnncttcatgttattccattttaatcgttcattcattcatataggcttttgattttttga |
313 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46543860 |
attcccatccatcaaacacttttttccttttcagtgtttttttcttcatgttattccattttaatcgttcattcattcatataggcttttgattttttga |
46543959 |
T |
 |
| Q |
314 |
ccatgactgtcataagatgcgatatggtggtgggattgtaca |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46543960 |
ccatgactgtcataagatgcgatatggtggtgggattgtaca |
46544001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 418 - 472
Target Start/End: Original strand, 46544064 - 46544118
Alignment:
| Q |
418 |
ggtttaaattcaacagatatatatagtgccactgtctctatttatttttcacttt |
472 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46544064 |
ggtttaaattcaacagatatatatagtgccactgtctctatttatttttcacttt |
46544118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University