View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14493_high_24 (Length: 354)
Name: NF14493_high_24
Description: NF14493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14493_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 13 - 332
Target Start/End: Original strand, 23339554 - 23339873
Alignment:
| Q |
13 |
attatactcattagaggccttttgtattggattgctcagttgcttggttctgttgttgcttgcttgctccttaaaattgccactggtggactggtgagaa |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23339554 |
attacactcattagaggccttttgtattggattgctcagttgcttggttctgttgttgcttgcttgctccttaaaattgccactggtggactggtgagaa |
23339653 |
T |
 |
| Q |
113 |
acattacattatatatttattcattttaaattgaatcgattgtgtcggaagtgatggtaacatgactttccctcatgtctccctcttgaaaagaacctga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23339654 |
acattacattatatatttattcattttaaatcgaatcgattgtgtcggaagtgatggtaacatgactttccctcatgtttccctcttgaaaagaacctga |
23339753 |
T |
 |
| Q |
213 |
attccattcctgaagtcatccatttagttggcagaccaactcgaggattagtctcatagcgcatccaaatgacttaaaccat-ggataccttataggagt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23339754 |
attccattcctgaagtcatccatttagttggcagaccaactcaaggattag-ctcatagcgcatccaaatgacttaaaccataggataccttataggagt |
23339852 |
T |
 |
| Q |
312 |
ctagtggaatgaaatacctta |
332 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
23339853 |
ctagtggaatgaaatacctta |
23339873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University