View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14493_high_29 (Length: 306)
Name: NF14493_high_29
Description: NF14493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14493_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 16 - 289
Target Start/End: Complemental strand, 29907814 - 29907541
Alignment:
| Q |
16 |
atgaatatagatatcctcagttgacagaaactacttcgattgtaatgacgggcatttactgggtgttaattatcttttactgtgttcgttaattttattt |
115 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29907814 |
atgaatataaatatcctcagttgacagaaactacttcgattgtaatgacgggcatttactgggtgttaattgtcttttactgtgttcgttaattttattt |
29907715 |
T |
 |
| Q |
116 |
tagggtgaaaatgatggattttatcctgctgaaatgtataaattgtttgtttagggtgcagccctttcaccttctaatgctgcagaatctggggagattg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29907714 |
tagggtgaaaatgatggattttatcctgctgaaatggataaattgtttgtttagggtgcagccctttcaccttctaatgctgcagaatctggggagattg |
29907615 |
T |
 |
| Q |
216 |
ttggctctgctaaggtttgacctccaatttaatacccacccctgatttgaacgacgacaacgttgtttgctact |
289 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29907614 |
ttggctctcctgaggtttgacctccaatttaatactcacccctgatttgaacgacgacaatgttgtttgctact |
29907541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University