View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14493_high_38 (Length: 238)
Name: NF14493_high_38
Description: NF14493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14493_high_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 14713438 - 14713217
Alignment:
| Q |
1 |
tttagattatctagattctggaaaaccttatcacatgatacagtaaaatatggcaccgtcc--aataccatttattggatgctaatcatagaaaacttta |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14713438 |
tttagattatctagattctggaaaaccttatcccatgatacagtaaaatatggcaccgtccccaataccatttattggatgctaatcatagaaaacttta |
14713339 |
T |
 |
| Q |
99 |
tgtcagttaggatcaaagaattgtgagtcatgtgatacaacatatccttagatactattgggtagcatttgagtaacataaaataagtgacattgataat |
198 |
Q |
| |
|
| ||| |||| || |||||||| ||||||||||||||| ||| ||| | ||||| || ||||| || ||| ||||||||| ||||||||| ||||||||| |
|
|
| T |
14713338 |
tctcatttagaat-aaagaattatgagtcatgtgatacgacacatcttgagatattagtgggtcgcttttcagtaacatagaataagtgatattgataat |
14713240 |
T |
 |
| Q |
199 |
attgatcaatcacaatatcaatt |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14713239 |
attgatcaatcacaatatcaatt |
14713217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University