View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14493_high_43 (Length: 219)
Name: NF14493_high_43
Description: NF14493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14493_high_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 21 - 205
Target Start/End: Complemental strand, 22342065 - 22341881
Alignment:
| Q |
21 |
gaatatgtgtgtgattgctggaaagtgacattcatataagaaaatagagacttctaaaagtattgtattctgaatttagaaaaatattaaaaatgtaaaa |
120 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22342065 |
gaatatatgtgtgattgctggaaagtgacattcatataagaaaatagagacttctaaaagtattgtattctgaatttagaaaaatattaaaaatgtaaaa |
22341966 |
T |
 |
| Q |
121 |
tgattatgaaagagtgtattaattaataggtagcttctgggatggactataatttttggctaaaatgcatttttgtccccctatg |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22341965 |
tgattatgaaagagtctattaattaataggtagcttctgggatggactataatttttggctaaaatgcatttttgttcccctatg |
22341881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University