View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14493_low_42 (Length: 228)
Name: NF14493_low_42
Description: NF14493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14493_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 54543595 - 54543784
Alignment:
| Q |
18 |
cactataaataggaattagttgtgaacgaagcaaaaccagaagtttgcnnnnnnnntacgcggtagatacacaccagtcagggagtggtaggccagcaag |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54543595 |
cactataaataggaattagttatgaacgaagcaaaaccagaagtttgcaaaaaaaatacgcgggagatacacaccagtcagggagtggtaggccagcaag |
54543694 |
T |
 |
| Q |
118 |
gtttgaatgttgcatccagacatttgctaagttgaagaaataaaagaacacaaactgataagacgagaaatggaagagtacagtttcagat |
208 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54543695 |
gtttgaatgttgcatccagacatttgc-aagttgaagaaataaaagaacacaaactgataagaagagaaatggaagagtacagtttcagat |
54543784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University