View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14493_low_43 (Length: 227)
Name: NF14493_low_43
Description: NF14493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14493_low_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 92 - 154
Target Start/End: Original strand, 30751922 - 30751984
Alignment:
| Q |
92 |
tagttgaatcatccatacttgaccttcaatttcaaacataatcgaattaatattcaatgtgtc |
154 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30751922 |
tagtttaatcatccatacttgaccttcaatttcaaacataatcgaattaatattaaatgtgtc |
30751984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 86 - 154
Target Start/End: Original strand, 16179130 - 16179197
Alignment:
| Q |
86 |
gtgaagtagttgaatcatccatacttgaccttcaatttcaaacataatcgaattaatattcaatgtgtc |
154 |
Q |
| |
|
|||||| ||||||||||||| |||||||||| ||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
16179130 |
gtgaagcagttgaatcatccttacttgacctgcaatttc-aacatagtcgaattaatatttaatgtgtc |
16179197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 86 - 154
Target Start/End: Original strand, 47648601 - 47648668
Alignment:
| Q |
86 |
gtgaagtagttgaatcatccatacttgaccttcaatttcaaacataatcgaattaatattcaatgtgtc |
154 |
Q |
| |
|
|||||| ||||||||||||| |||||||||| ||||||| |||||||||||||||||| | |||||||| |
|
|
| T |
47648601 |
gtgaagcagttgaatcatccttacttgacctgcaatttc-aacataatcgaattaatagttaatgtgtc |
47648668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University