View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14493_low_45 (Length: 218)
Name: NF14493_low_45
Description: NF14493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14493_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 15 - 111
Target Start/End: Original strand, 13878692 - 13878788
Alignment:
| Q |
15 |
cctcgctcttctctttagctttttgaactgtcgatagattcttcgtggtatttgtaaacttcagtccctccagcaatggtcccatttgtgaatgtac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13878692 |
cctcgctcttctctttagctttttgaactgtcgatagattcttcttggtatttgtaaacttcagtccctccagcaatggtcccatttgtgaatgtac |
13878788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 35 - 167
Target Start/End: Original strand, 13884187 - 13884317
Alignment:
| Q |
35 |
ttttgaactgtcgatagattcttcgtggtatttgtaaacttcagtccctccagcaatggtcccatttgtgaatgtacacctggtgttgcagaatcaccaa |
134 |
Q |
| |
|
||||||||||||||| |||||||| |||||| || ||||||||| ||||||||||||| ||||||||||||||| ||||| | ||||| ||||| ||| |
|
|
| T |
13884187 |
ttttgaactgtcgatcgattcttcttggtatctgctaacttcagtgcctccagcaatggccccatttgtgaatgt--acctgatcttgcaaaatcatcaa |
13884284 |
T |
|
| Q |
135 |
cccaaaccatgagaaagaaacaaaaattcagca |
167 |
Q |
| |
|
|| ||||||||| ||||||| || |||||||| |
|
|
| T |
13884285 |
cctaaaccatgataaagaaagaagcattcagca |
13884317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 20 - 174
Target Start/End: Original strand, 13882364 - 13882516
Alignment:
| Q |
20 |
ctcttctctttagctttttgaactgtcgata-gattcttcgtggtatttgtaaacttcagtccctccagcaatggtcccatttgtgaatgtacacctggt |
118 |
Q |
| |
|
||||||||||| |||||| ||||||| ||| |||||||| |||||| || |||||||||| |||||||| |||| |||| | ||||||||| ||||| |
|
|
| T |
13882364 |
ctcttctctttggctttt-gaactgttgatttgattcttcttggtatctgcaaacttcagtgcctccagcgatggccccaatcgtgaatgtaa--ctggt |
13882460 |
T |
|
| Q |
119 |
gttgcagaatcaccaacccaaaccatgagaaagaaacaaaaattcagcaatacatt |
174 |
Q |
| |
|
||||| |||||||| | ||||||||| ||||||||||| |||||||| |||||| |
|
|
| T |
13882461 |
cttgcaaaatcaccactctaaaccatgataaagaaacaaacattcagcagtacatt |
13882516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 115 - 175
Target Start/End: Original strand, 13871985 - 13872045
Alignment:
| Q |
115 |
tggtgttgcagaatcaccaacccaaaccatgagaaagaaacaaaaattcagcaatacatta |
175 |
Q |
| |
|
|||| |||||||||||||| | ||||||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
13871985 |
tggtcttgcagaatcaccactctaaaccatgataaagaaacaaacattcagcagtacatta |
13872045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University