View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14493_low_46 (Length: 207)
Name: NF14493_low_46
Description: NF14493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14493_low_46 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 137 - 188
Target Start/End: Original strand, 12781093 - 12781144
Alignment:
| Q |
137 |
gcaaaaataaagtgatgtggcatgcgaaatgataattagtgatattttatga |
188 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12781093 |
gcaaaaataaaatgatgtggcatgcgaaatgataattagtgatattttatga |
12781144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 137 - 188
Target Start/End: Original strand, 12785275 - 12785326
Alignment:
| Q |
137 |
gcaaaaataaagtgatgtggcatgcgaaatgataattagtgatattttatga |
188 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12785275 |
gcaaaaataaagtgatgtggcctgcgaaatgataattagtgatattttatga |
12785326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University