View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14493_low_46 (Length: 207)

Name: NF14493_low_46
Description: NF14493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14493_low_46
NF14493_low_46
[»] chr6 (2 HSPs)
chr6 (137-188)||(12781093-12781144)
chr6 (137-188)||(12785275-12785326)


Alignment Details
Target: chr6 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 137 - 188
Target Start/End: Original strand, 12781093 - 12781144
Alignment:
137 gcaaaaataaagtgatgtggcatgcgaaatgataattagtgatattttatga 188  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||    
12781093 gcaaaaataaaatgatgtggcatgcgaaatgataattagtgatattttatga 12781144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 137 - 188
Target Start/End: Original strand, 12785275 - 12785326
Alignment:
137 gcaaaaataaagtgatgtggcatgcgaaatgataattagtgatattttatga 188  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||    
12785275 gcaaaaataaagtgatgtggcctgcgaaatgataattagtgatattttatga 12785326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University