View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14494_high_28 (Length: 252)
Name: NF14494_high_28
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14494_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 244
Target Start/End: Complemental strand, 4880866 - 4880631
Alignment:
| Q |
9 |
aattaatttaactcttagtgtatattataaattattataaagattaattactgataactatgaatttttgttgattatttaatttcagcctggatcaact |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4880866 |
aattaatttaactcttagtgtatattataaattattataaagattaattactgataactatgaatttttgttgattatttaatttcagcctggatcaact |
4880767 |
T |
 |
| Q |
109 |
tcacatgcttgctcacaaccatagaaagtacagtgacaagggcaacaaccgactggaaataactcagatgttcaattactattataattttcagtgattg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4880766 |
tcacatgcttgctcacaaccatagaaagtacagtgacaagggcaacaaccgactggaaataattcagatgttcaattactattataattttcagtgattg |
4880667 |
T |
 |
| Q |
209 |
aaatatgaaagcactactcattagcatagtattatc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4880666 |
aaatatgaaagcactactcattagcatagtattatc |
4880631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University