View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14494_high_31 (Length: 246)
Name: NF14494_high_31
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14494_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 44828108 - 44828323
Alignment:
| Q |
19 |
tttttagttttgcatgaagcaactatactcaaatttatgtcctgtttgttttcaaacattgtttctggactgtccatattgtttgnnnnnnnccctacag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||| | |||| | ||||| |||||||||||||||| |||| || |
|
|
| T |
44828108 |
tttttagttttgcatgaagcaactatacccaaatttatgtcctgtttgtattcgagcattatatctgggctgtccatattgtttgtttttttccctgaag |
44828207 |
T |
|
| Q |
119 |
tgtgttagatcttatcacgtaccttctcaggtgttacaaagtacttatgtgtgttgaatttggacctaaatattttatggtaacatgaatttgttcttgc |
218 |
Q |
| |
|
||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44828208 |
tgtgtatgatcttaacacgtaccttcctaggtgttacaaagtacttatgtgtgttgaatttcgacctaaatattttatggtaacatgaatttgttcttgc |
44828307 |
T |
|
| Q |
219 |
tagatttcttcatatt |
234 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44828308 |
tagatttcttcatatt |
44828323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University