View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14494_high_33 (Length: 241)

Name: NF14494_high_33
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14494_high_33
NF14494_high_33
[»] chr7 (1 HSPs)
chr7 (159-207)||(23854851-23854899)


Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 159 - 207
Target Start/End: Complemental strand, 23854899 - 23854851
Alignment:
159 tatattgaatgaaattaatgaatttcatttaattatattgattaaattc 207  Q
    ||||| |||||||||||||| ||||||||||||||||||||||||||||    
23854899 tatatcgaatgaaattaatgtatttcatttaattatattgattaaattc 23854851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University