View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14494_high_33 (Length: 241)
Name: NF14494_high_33
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14494_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 159 - 207
Target Start/End: Complemental strand, 23854899 - 23854851
Alignment:
| Q |
159 |
tatattgaatgaaattaatgaatttcatttaattatattgattaaattc |
207 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23854899 |
tatatcgaatgaaattaatgtatttcatttaattatattgattaaattc |
23854851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University