View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14494_high_35 (Length: 227)

Name: NF14494_high_35
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14494_high_35
NF14494_high_35
[»] chr8 (2 HSPs)
chr8 (16-210)||(43883405-43883598)
chr8 (81-129)||(13408263-13408311)
[»] chr1 (1 HSPs)
chr1 (100-143)||(12581749-12581792)


Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 210
Target Start/End: Original strand, 43883405 - 43883598
Alignment:
16 actaatcttgattgttcgaactcaaatcaatgatgaagattatttgaagatatgttggtgaaggtgtgtaatgtatgtcaaccgatctcaaatcgattgt 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
43883405 actaatcttgattgttcgaactcaaatcaatgatgaagattatttgaagatatgttggtgaaggtgtgtaatgtatgtcagccgatctcaaatcgattgt 43883504  T
116 cgagatcaattaatgtgtataactgtgtcttttttacttgcactgaatccagattcatgtaaatataataaagtcattggtatgttggaacttct 210  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43883505 cgagatcaattaatgtgtataactgtgtcttttttac-tgcactgaatccagattcatgtaaatataataaagtcattggtatgttggaacttct 43883598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 129
Target Start/End: Original strand, 13408263 - 13408311
Alignment:
81 gtgtaatgtatgtcaaccgatctcaaatcgattgtcgagatcaattaat 129  Q
    ||||||||| ||||||||||| ||||||| ||  |||||||||||||||    
13408263 gtgtaatgtttgtcaaccgatttcaaatctatgatcgagatcaattaat 13408311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 100 - 143
Target Start/End: Original strand, 12581749 - 12581792
Alignment:
100 atctcaaatcgattgtcgagatcaattaatgtgtataactgtgt 143  Q
    |||||||||| ||||||||||||||||||| ||||||| |||||    
12581749 atctcaaatcaattgtcgagatcaattaatatgtataaatgtgt 12581792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University