View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14494_high_36 (Length: 225)
Name: NF14494_high_36
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14494_high_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 209
Target Start/End: Original strand, 21601704 - 21601896
Alignment:
| Q |
17 |
ttctgagaatggaaattgcgacaagttgtgccgtgagatcggatataaaggaggagactgtaatccaggatattgttgctgtgatgtataatcagaattg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21601704 |
ttctgagaatggaaattgcgacaagttgtgccgtgagatcggatataaaggaggagactgtaatccagggtattgttgctgtgatgtataatcagaattg |
21601803 |
T |
|
| Q |
117 |
aattacatgattataaatatttatgtgttttactaattatcgaataaacaatcatatcaagaagatgattgaataaactaaataagaaacatc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21601804 |
aattacatgattataaatatttatgtgttttactaattatcgaataaacaatcatatcaagaagatgattgaataaactaaataagaaacatc |
21601896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University