View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14494_low_17 (Length: 402)
Name: NF14494_low_17
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14494_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 42 - 383
Target Start/End: Complemental strand, 7742485 - 7742149
Alignment:
| Q |
42 |
gataaaactcggcctcctccgcttatttccaccgccgccgcctctttcatcctcttcatcttcatcttcatgcattcgtcgacgacgactcatcgctgca |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7742485 |
gataaaactcggcctcctccgcttatttccaccgccgccgcctctttcatcctcttcatcttcat------gcattcgtcgacgacgactcatcgctgca |
7742392 |
T |
|
| Q |
142 |
aaccctagattgaattttaacgaattttgtttttgttggaagctttacgattggaattggaatatggaagctttacgattggaattttgttcttgaaacg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7742391 |
aaccctagattgaattttaacgaattttgtttttgttggaagctttacgattggaattggaatatggaagctttacgattggaattttgttcttgaaacg |
7742292 |
T |
|
| Q |
242 |
agggtgaaggagaatggtagtggagagtgatcgagagattgaggaagaatagatatagattggaggttaagagttggaatttaaacactctcacttgaaa |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7742291 |
agggtgaaggagaatggtagtggagagtgatcgagagattgaggaagaatagatatagattggaggttaagagttggaatttaaacactctcacttgaaa |
7742192 |
T |
|
| Q |
342 |
ttcttgcatgcaaatgcacctaa-atataaagttttacacaca |
383 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
7742191 |
ttcttgcatgcaaatgcacctaacgtataaggttttacacaca |
7742149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 83
Target Start/End: Complemental strand, 40863507 - 40863466
Alignment:
| Q |
42 |
gataaaactcggcctcctccgcttatttccaccgccgccgcc |
83 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||| ||||| |
|
|
| T |
40863507 |
gataaaactgggcctcctccgcttctttccaccgccaccgcc |
40863466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University