View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14494_low_20 (Length: 367)
Name: NF14494_low_20
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14494_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 52862723 - 52862443
Alignment:
| Q |
1 |
agacacaatcagaacggaagggctgccgggagggattttgccttcaacgacttcactttcacacagcacctgtctccaacaattcccaaatgcaccttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52862723 |
agacacaatcagaacggaagggctgccgggagggattttgccttcaacgacttcactttcacacagcacctgtctccaacaattcccaaatgcaccttta |
52862624 |
T |
|
| Q |
101 |
atatctccacctaacaatttcatatccaaatctgtatctcttgaattttgagaatttgatagctccaaaatcaaactatctgctttcagggattccaact |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52862623 |
atatctccacctaacaatttcacatccaaatctgtatctcttgaattttgagaatttgatagctccaaaatcgaactatctgctttcagggattccaact |
52862524 |
T |
|
| Q |
201 |
cgatagaagagagttgaacatcattggcagattgaaattcattcacaaagaaacgcagttgctcggagcctgttgtttccg |
281 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52862523 |
ctatagaagagagttgaacatcattggcagattgaaattcattcacaaagaaacgcagttgctcggagcctgttgtttccg |
52862443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 11 - 101
Target Start/End: Original strand, 14744529 - 14744619
Alignment:
| Q |
11 |
agaacggaagggctgccgggagggattttgccttcaacgacttcactttcacacagcacctgtctccaacaattcccaaatgcacctttaa |
101 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||| ||||||||||||| |||| ||||| ||| ||||||||| |||| |||||| |
|
|
| T |
14744529 |
agaacggaagggctgccgggaggaattttgccttgaacgatttcactttcacactgcacgtgtcttcaagaattcccaactgcagctttaa |
14744619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 11 - 101
Target Start/End: Complemental strand, 35296466 - 35296376
Alignment:
| Q |
11 |
agaacggaagggctgccgggagggattttgccttcaacgacttcactttcacacagcacctgtctccaacaattcccaaatgcacctttaa |
101 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||| ||||| ||||||||||||| |||| ||||| ||| ||||||||| |||| |||||| |
|
|
| T |
35296466 |
agaacggaatggctgccgggaggaattttgccttgaacgatttcactttcacactgcacgtgtcttcaagaattcccaactgcagctttaa |
35296376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 179 - 264
Target Start/End: Complemental strand, 33355494 - 33355408
Alignment:
| Q |
179 |
tctgctttcagggattccaactcgatagaagagagttgaacatcattggc--agattgaaattcattcacaaagaaacgcagttgctc |
264 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| ||| ||||| ||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
33355494 |
tctggtttgagggattccaactcgatagaagagagttgaagatc-ttggcagagattgaaattgattcttaaagaaacgcaattgctc |
33355408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 179 - 264
Target Start/End: Original strand, 33544093 - 33544179
Alignment:
| Q |
179 |
tctgctttcagggattccaactcgatagaagagagttgaacatcattggc--agattgaaattcattcacaaagaaacgcagttgctc |
264 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| ||| ||||| ||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
33544093 |
tctggtttgagggattccaactcgatagaagagagttgaagatc-ttggcagagattgaaattgattcttaaagaaacgcaattgctc |
33544179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 188 - 264
Target Start/End: Original strand, 33546947 - 33547024
Alignment:
| Q |
188 |
agggattccaactcgatagaagagagttgaacatcattggc--agattgaaattcattcacaaagaaacgcagttgctc |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||| ||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
33546947 |
agggattccaactcgatagaagagagttgaagatc-ttggcagagattgaaattggttcttaaagaaacgcaattgctc |
33547024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 264
Target Start/End: Original strand, 33547900 - 33547986
Alignment:
| Q |
179 |
tctgctttcagggattccaactcgatagaagagagttgaacatcattggc--agattgaaattcattcacaaagaaacgcagttgctc |
264 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||| ||| ||||| ||||||||| | |||| ||||||||||| |||||| |
|
|
| T |
33547900 |
tctggtttgagggattccaactcgatagaagatagttgaagatc-ttggcagagattgaaactgattcttaaagaaacgcaattgctc |
33547986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University