View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14494_low_25 (Length: 311)
Name: NF14494_low_25
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14494_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 15 - 296
Target Start/End: Original strand, 31841294 - 31841570
Alignment:
| Q |
15 |
aatattactacgtgtagtaaatgatatacgatagtataaagttataaacttaattttacattggccatgttgagtgttgttcacaaaatatattaattaa |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31841294 |
aatactactacgtgtagtaaatgatatacgatagtataaagttataaacttaattttacattggccatgttgagtgttgttcacaaaatatatta----a |
31841389 |
T |
|
| Q |
115 |
ttttggtctcttcttttgtgttgtgaatagtgtttaacatatcattcattcattaactagttattaattattctgttctggtaacagataacttatttaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31841390 |
ttttggtctcttcttttgtgttgtgaatagtgtttaacatatcattcattcattaactagttattaattattctgttctggtaacagataacttatttaa |
31841489 |
T |
|
| Q |
215 |
caagcnnnnnnnntaactgcagaggtttcagtcttcagatatagtaatacgagtgatgctctaattgtgacatcataagttg |
296 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31841490 |
caagcaaaaaaaa-aactgcagaggtttcagtcttcagatatagtaatacgagtgatgctctaattgtgacatcataagttg |
31841570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University