View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14494_low_29 (Length: 277)

Name: NF14494_low_29
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14494_low_29
NF14494_low_29
[»] chr8 (2 HSPs)
chr8 (141-260)||(37316957-37317080)
chr8 (15-81)||(37317146-37317212)


Alignment Details
Target: chr8 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 141 - 260
Target Start/End: Complemental strand, 37317080 - 37316957
Alignment:
141 atcaattatcaatgactggggtacaaaggac----aaatagaaggaaaacaccaaaaatgtgcactaattgtagtagaagcaatacccnnnnnnnttgtc 236  Q
    ||||||||||||| |||||||||||||||||     ||||||||||||||||||||||||||||| ||||||||||||||||||||||       |||||    
37317080 atcaattatcaattactggggtacaaaggactaattaatagaaggaaaacaccaaaaatgtgcaccaattgtagtagaagcaatacccaaaaaaattgtc 37316981  T
237 attatttaacttcagaaaatatgt 260  Q
    ||||||||||||||||||||||||    
37316980 attatttaacttcagaaaatatgt 37316957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 15 - 81
Target Start/End: Complemental strand, 37317212 - 37317146
Alignment:
15 atgaatgaaggtttgatgttttgaagtgattgatccaaaattgatttctatatcaattgattccaat 81  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37317212 atgaatgaaggtttgatgttttgaagtgattgatccaaaattgatttctatatcaattgattccaat 37317146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University