View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14494_low_29 (Length: 277)
Name: NF14494_low_29
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14494_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 141 - 260
Target Start/End: Complemental strand, 37317080 - 37316957
Alignment:
| Q |
141 |
atcaattatcaatgactggggtacaaaggac----aaatagaaggaaaacaccaaaaatgtgcactaattgtagtagaagcaatacccnnnnnnnttgtc |
236 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
37317080 |
atcaattatcaattactggggtacaaaggactaattaatagaaggaaaacaccaaaaatgtgcaccaattgtagtagaagcaatacccaaaaaaattgtc |
37316981 |
T |
 |
| Q |
237 |
attatttaacttcagaaaatatgt |
260 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37316980 |
attatttaacttcagaaaatatgt |
37316957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 15 - 81
Target Start/End: Complemental strand, 37317212 - 37317146
Alignment:
| Q |
15 |
atgaatgaaggtttgatgttttgaagtgattgatccaaaattgatttctatatcaattgattccaat |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37317212 |
atgaatgaaggtttgatgttttgaagtgattgatccaaaattgatttctatatcaattgattccaat |
37317146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University