View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14494_low_31 (Length: 252)

Name: NF14494_low_31
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14494_low_31
NF14494_low_31
[»] chr7 (1 HSPs)
chr7 (171-233)||(27039000-27039062)


Alignment Details
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 27039062 - 27039000
Alignment:
171 aaggtaatgtttctataattcatattttgaggcaaaatactcgactacaaccaggttgaagat 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
27039062 aaggtaatgtttctataattcatattttgaggcaaaatactcgactacaaccacgttgaagat 27039000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University