View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14494_low_34 (Length: 247)
Name: NF14494_low_34
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14494_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 43574974 - 43574760
Alignment:
| Q |
18 |
acatgggaacggggaagacgagtttggttcttagatttgtcaaaggtcaattttcggaataccaggttgctatatgattgtttcttttcattatgtcttc |
117 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43574974 |
acatgggaacggggaagactagtttggttcttagatttgtcaaaggtcaattttcggaataccaggttgctatatgattgtttcttttctttatgtcttc |
43574875 |
T |
 |
| Q |
118 |
acatcattatagatgacttaaattattgatnnnnnnngaagataatttaatttggattaccttaaattaatgtgtgcaggaatcaacaatcggagcggca |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
43574874 |
acatcattatagatgactcaaattattgataaaaaaataagataatttaatttgaattaccttaaatgaatgtgtgcaggaatcaacaatcggagccgca |
43574775 |
T |
 |
| Q |
218 |
tttttcacacaggtt |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43574774 |
tttttcacacaggtt |
43574760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University