View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14494_low_36 (Length: 243)
Name: NF14494_low_36
Description: NF14494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14494_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 4881054 - 4880871
Alignment:
| Q |
18 |
attgtgtggatgtgatgatgttcatacatgtgtggtaaggaaattaaatctatgaaacactaaatcacatggatactaacacgctgacattgctgataat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
4881054 |
attgtgtggatgtgatgatgttcatacatgtgtggtaaggaaattaaatctatgaaacactgaaacacacggatactaacacgccgacattgctaataat |
4880955 |
T |
|
| Q |
118 |
ttnnnnnnnttacataatacagtgtagttctatttttgatgtcatatcgttgtagtatacaacgcgtgcccgacactgagacac |
201 |
Q |
| |
|
|| |||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
4880954 |
ttaaaaaaattacataatacagtgtagttatatttttgatgtcgtatcgttgtagtatataacgcgtgcccgacactgaaacac |
4880871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University