View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14495_low_14 (Length: 236)
Name: NF14495_low_14
Description: NF14495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14495_low_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 29 - 236
Target Start/End: Complemental strand, 48518486 - 48518279
Alignment:
| Q |
29 |
taaccaagaaagtcctcatcttcattctccaaagactggaatcattattgttcttgaatttctccacctagaacttagtagaacccatccttgcctttga |
128 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48518486 |
taaccaagaaaatcctcatcttcattctccaaagactggaatcattattgttcttgaatttctccacctagaacttagtagaacccgtccttgcctttga |
48518387 |
T |
 |
| Q |
129 |
tgaattaccctgaaacattaaccagagctgctgatacccatctgttatataaacaaaacctgcaacttgattgcagtgacaaacatgaacaagaatataa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48518386 |
tgaattaccctgaaacattaaccagagctgctgataacaatctgttatataaacaaaacctgcaacttgattgcagtgacaaacatgaacaagaatatag |
48518287 |
T |
 |
| Q |
229 |
tggcaatt |
236 |
Q |
| |
|
|||||||| |
|
|
| T |
48518286 |
tggcaatt |
48518279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University