View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14495_low_15 (Length: 218)
Name: NF14495_low_15
Description: NF14495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14495_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 22 - 209
Target Start/End: Complemental strand, 32974332 - 32974145
Alignment:
| Q |
22 |
ttggaggagagaggaggagcggtgggttcatggttgacatggtgaacgttggaagaaggaaaatgagggttatgggtttcatgagaaacatggtgaacag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32974332 |
ttggaggagagaggaggagcggtgggttcatggttgacatggtgaacgttggaagaaggaaaatgagggttatgggtttcatgagaaacatggtgaacag |
32974233 |
T |
 |
| Q |
122 |
ttgcgtttgggaatggggcggaggtgtgatccggtacggatggtggtgcaggtgagtacgcagcgccgtagctgggttgttgatgatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32974232 |
ttgcgtttgggaatggggcggaggtgtgatccggtacggatggtggtgcaggtgggtacgcagcgccgtagctgggttgttgatgatg |
32974145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University