View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14496_high_2 (Length: 229)
Name: NF14496_high_2
Description: NF14496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14496_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 9336452 - 9336649
Alignment:
| Q |
19 |
atgttaccccattgtcacttggtatcgcaacatataaggaaaatatcatgaatgtggtgattcctagaaacacttccatacctgtcaagaagacaaatgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9336452 |
atgttaccccattgtcacttggtatcgcaacatataaggaaaatatcatgagtgtggtgattcctagaaacacttccatacctgtcaagaagacaaatgg |
9336551 |
T |
 |
| Q |
119 |
atatttcaccctttatgataaccagtgcattgtcgattttcctgtttatgagggtgagagaccaagagctactgacaataatctgcttggttcatttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9336552 |
atatttcaccctttatgataaccagtgcattgtcgattttcctgtttatgagggtgagagaccaagagctactgacaataatctgcttggttcatttc |
9336649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 61 - 111
Target Start/End: Complemental strand, 35132024 - 35131974
Alignment:
| Q |
61 |
atatcatgaatgtggtgattcctagaaacacttccatacctgtcaagaaga |
111 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
35132024 |
atatcatgaatgtggtgattcctaggaacacttgcattcctgtcaagaaga |
35131974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 20)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 61 - 215
Target Start/End: Complemental strand, 8666984 - 8666830
Alignment:
| Q |
61 |
atatcatgaatgtggtgattcctagaaacacttccatacctgtcaagaagacaaatggatatttcaccctttatgataaccagtgcattgtcgattttcc |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||||||| ||||| |||||| |
|
|
| T |
8666984 |
atatcatgagtgtggtgattcctagaaacacttccatacctgtcaagaagacaagtcgatattccaccctttatgataaccagtgccttgtcaattttct |
8666885 |
T |
 |
| Q |
161 |
tgtttatgagggtgagagaccaagagctactgacaataatctgcttggttcattt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8666884 |
tgtttatgagggtgagagaccaagagctgctgacaataatctgcttggttcattt |
8666830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 152
Target Start/End: Original strand, 8671659 - 8671792
Alignment:
| Q |
19 |
atgttaccccattgtcacttggtatcgcaacatataaggaaaatatcatgaatgtggtgattcctagaaacacttccatacctgtcaagaagacaaatgg |
118 |
Q |
| |
|
||||||| ||||||||||||||||| || || | ||| ||||||||| |||||||||||| |||||||||||||||||||||| ||||||||| | |
|
|
| T |
8671659 |
atgttacgccattgtcacttggtattgctgcaaggattgaacatatcatgagtgtggtgattccaagaaacacttccatacctgtcacaaagacaaatcg |
8671758 |
T |
 |
| Q |
119 |
atatttcaccctttatgataaccagtgcattgtc |
152 |
Q |
| |
|
|||| |||| | |||||||||||| |||||||| |
|
|
| T |
8671759 |
atataccaccttatatgataaccagcgcattgtc |
8671792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 8654057 - 8653858
Alignment:
| Q |
19 |
atgttaccccattgtcacttggtatcgcaaca------tataaggaaaatatcatgaatgtggtgattcctagaaacacttccatacctgtcaagaagac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||| ||||||||||| |||||||| || || |
|
|
| T |
8654057 |
atgttaccccattgtcacttggtatcgcaacagcaacatattgggaaaatatcatggatgtggtgattcctaggaacacttccatccctgtcaaaaatac |
8653958 |
T |
 |
| Q |
113 |
aaatggatatttcacc-ctttatgataaccagtgcattgtcgattttcctgtttatgagggtgagagaccaagagctactgacaataatctgcttggttc |
211 |
Q |
| |
|
|| ||||||| || || || ||||| || || | | || ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8653957 |
taaaggatattgtacagctata-gataat---tgtggtgcctctattattgtttatgagggtgagagaccaagagctagtgacaataatctgcttggttt |
8653862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 108
Target Start/End: Original strand, 10494935 - 10495024
Alignment:
| Q |
19 |
atgttaccccattgtcacttggtatcgcaacatataaggaaaatatcatgaatgtggtgattcctagaaacacttccatacctgtcaaga |
108 |
Q |
| |
|
||||||||||||||||||||||||| | | | || ||| |||||||| |||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
10494935 |
atgttaccccattgtcacttggtattgaagtaacaaatgaagatatcatggatgtggtgattcctaggaacacttccatccctgtcaaga |
10495024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 61 - 112
Target Start/End: Original strand, 13333968 - 13334019
Alignment:
| Q |
61 |
atatcatgaatgtggtgattcctagaaacacttccatacctgtcaagaagac |
112 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
13333968 |
atatcatgaatgttgtgattcctaggaacacttccatccctgtcaagaagac |
13334019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 13334072 - 13334122
Alignment:
| Q |
165 |
tatgagggtgagagaccaagagctactgacaataatctgcttggttcattt |
215 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||| |||||||||||| |
|
|
| T |
13334072 |
tatgagggtgagagagcaagagctagtgacaataatctacttggttcattt |
13334122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 3146731 - 3146682
Alignment:
| Q |
162 |
gtttatgagggtgagagaccaagagctactgacaataatctgcttggttc |
211 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||| |||||||||||||| |
|
|
| T |
3146731 |
gtttatgagggtgagagagcaagagctagtgacaacaatctgcttggttc |
3146682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 8586407 - 8586453
Alignment:
| Q |
162 |
gtttatgagggtgagagaccaagagctactgacaataatctgcttgg |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
8586407 |
gtttatgagggtgagagagcaagagctagtgacaacaatctgcttgg |
8586453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 8646345 - 8646295
Alignment:
| Q |
161 |
tgtttatgagggtgagagaccaagagctactgacaataatctgcttggttc |
211 |
Q |
| |
|
||||||||||||||||||| ||||||| | |||||| |||||||||||||| |
|
|
| T |
8646345 |
tgtttatgagggtgagagagcaagagcaagtgacaacaatctgcttggttc |
8646295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 10495078 - 10495128
Alignment:
| Q |
165 |
tatgagggtgagagaccaagagctactgacaataatctgcttggttcattt |
215 |
Q |
| |
|
||||||||||||||| ||||||||| ||| |||||||| |||||||||||| |
|
|
| T |
10495078 |
tatgagggtgagagagcaagagctagtgagaataatctacttggttcattt |
10495128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 17259700 - 17259654
Alignment:
| Q |
165 |
tatgagggtgagagaccaagagctactgacaataatctgcttggttc |
211 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
17259700 |
tatgagggtgagagaccaagagcaactgacaatcatcttcttggttc |
17259654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 8616181 - 8616136
Alignment:
| Q |
163 |
tttatgagggtgagagaccaagagctactgacaataatctgcttgg |
208 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
8616181 |
tttatgagggtgagagatcaagagctagtgacaacaatctgcttgg |
8616136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 17267403 - 17267357
Alignment:
| Q |
165 |
tatgagggtgagagaccaagagctactgacaataatctgcttggttc |
211 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| |||| |||||||| |
|
|
| T |
17267403 |
tatgagggtgagagaccaagagcaagtgacaatcatcttcttggttc |
17267357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 17275057 - 17275011
Alignment:
| Q |
165 |
tatgagggtgagagaccaagagctactgacaataatctgcttggttc |
211 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| |||| |||||||| |
|
|
| T |
17275057 |
tatgagggtgagagaccaagagcaagtgacaatcatcttcttggttc |
17275011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 6788979 - 6788926
Alignment:
| Q |
162 |
gtttatgagggtgagagaccaagagctactgacaataatctgcttggttcattt |
215 |
Q |
| |
|
|||||||||||||| ||||||||||| | ||| || |||||||| ||||||||| |
|
|
| T |
6788979 |
gtttatgagggtgaaagaccaagagccagtgataacaatctgctcggttcattt |
6788926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 47
Target Start/End: Complemental strand, 1301068 - 1301040
Alignment:
| Q |
19 |
atgttaccccattgtcacttggtatcgca |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1301068 |
atgttaccccattgtcacttggtatcgca |
1301040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 47
Target Start/End: Complemental strand, 8658970 - 8658942
Alignment:
| Q |
19 |
atgttaccccattgtcacttggtatcgca |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8658970 |
atgttaccccattgtcacttggtatcgca |
8658942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 108
Target Start/End: Complemental strand, 17259801 - 17259757
Alignment:
| Q |
64 |
tcatgaatgtggtgattcctagaaacacttccatacctgtcaaga |
108 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| || |||||||||| |
|
|
| T |
17259801 |
tcatgagtgtggtgattcctaggaacacttcaattcctgtcaaga |
17259757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 108
Target Start/End: Complemental strand, 17267504 - 17267460
Alignment:
| Q |
64 |
tcatgaatgtggtgattcctagaaacacttccatacctgtcaaga |
108 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| || |||||||||| |
|
|
| T |
17267504 |
tcatgagtgtggtgattcctaggaacacttcaattcctgtcaaga |
17267460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 113
Target Start/End: Original strand, 29582441 - 29582493
Alignment:
| Q |
61 |
atatcatgaatgtggtgattcctagaaacacttccatacctgtcaagaagaca |
113 |
Q |
| |
|
||||||||| ||||||||||||||| |||||| |||| |||| ||||| |||| |
|
|
| T |
29582441 |
atatcatgagtgtggtgattcctaggaacactcccattcctgccaagatgaca |
29582493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 163 - 211
Target Start/End: Original strand, 53416761 - 53416809
Alignment:
| Q |
163 |
tttatgagggtgagagaccaagagctactgacaataatctgcttggttc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53416761 |
tttatgagggtgagagaccaagagctactgacaataatctgcttggttc |
53416809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 29465313 - 29465263
Alignment:
| Q |
165 |
tatgagggtgagagaccaagagctactgacaataatctgcttggttcattt |
215 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
29465313 |
tatgagggtgagagagcaagagctagtgacaattatctgcttggttcattt |
29465263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 162 - 209
Target Start/End: Complemental strand, 15594502 - 15594455
Alignment:
| Q |
162 |
gtttatgagggtgagagaccaagagctactgacaataatctgcttggt |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||| |||||||| |
|
|
| T |
15594502 |
gtttatgagggtgagagagcaagagctagtgacaataatttgcttggt |
15594455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 4679255 - 4679304
Alignment:
| Q |
162 |
gtttatgagggtgagagaccaagagctactgacaataatctgcttggttc |
211 |
Q |
| |
|
|||||||||||||||||| ||||||| || ||||| |||||||||||||| |
|
|
| T |
4679255 |
gtttatgagggtgagagagcaagagcaacagacaacaatctgcttggttc |
4679304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 161 - 210
Target Start/End: Original strand, 16658220 - 16658269
Alignment:
| Q |
161 |
tgtttatgagggtgagagaccaagagctactgacaataatctgcttggtt |
210 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
16658220 |
tgtttatgagggtgagagagcaagagctgctgacaataatctgctcggtt |
16658269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 61 - 113
Target Start/End: Original strand, 12259181 - 12259233
Alignment:
| Q |
61 |
atatcatgaatgtggtgattcctagaaacacttccatacctgtcaagaagaca |
113 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
12259181 |
atatcatggatgtggtgattcctaggaacacttgcattcctgtcaagaagaca |
12259233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 62 - 115
Target Start/End: Complemental strand, 14702975 - 14702922
Alignment:
| Q |
62 |
tatcatgaatgtggtgattcctagaaacacttccatacctgtcaagaagacaaa |
115 |
Q |
| |
|
||||||| |||||||||||||||| ||||||| ||| |||||||| |||||||| |
|
|
| T |
14702975 |
tatcatggatgtggtgattcctaggaacacttgcattcctgtcaaaaagacaaa |
14702922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 14702874 - 14702820
Alignment:
| Q |
163 |
tttatgagggtgagagaccaagagctactgacaataatctgcttggttcatttca |
217 |
Q |
| |
|
||||||||||||||||| ||||||| | |||||||||| || ||||||| ||||| |
|
|
| T |
14702874 |
tttatgagggtgagagaacaagagccagtgacaataatttgattggttcttttca |
14702820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 114
Target Start/End: Complemental strand, 43624977 - 43624927
Alignment:
| Q |
64 |
tcatgaatgtggtgattcctagaaacacttccatacctgtcaagaagacaa |
114 |
Q |
| |
|
|||||| ||||||||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
43624977 |
tcatgagtgtggtgattcctaggaatacttctgtacctgtcaagaagacaa |
43624927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 43744283 - 43744234
Alignment:
| Q |
162 |
gtttatgagggtgagagaccaagagctactgacaataatctgcttggttc |
211 |
Q |
| |
|
|||||||||||||||||| ||||||| | |||||| |||||||||||||| |
|
|
| T |
43744283 |
gtttatgagggtgagagagcaagagcaagtgacaacaatctgcttggttc |
43744234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Complemental strand, 28219386 - 28219336
Alignment:
| Q |
161 |
tgtttatgagggtgagagaccaagagctactgacaataatctgcttggttc |
211 |
Q |
| |
|
||||||||||||||||||| ||| ||| | |||||| |||||||||||||| |
|
|
| T |
28219386 |
tgtttatgagggtgagagagcaaaagcaagtgacaacaatctgcttggttc |
28219336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University