View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14496_low_1 (Length: 417)
Name: NF14496_low_1
Description: NF14496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14496_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 2e-50; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 32211571 - 32211454
Alignment:
| Q |
1 |
acaatatttttggtattaccttcaaattttagtcgtaggtatatatagataggtataggtgcttagggctatacatatgataaaaggacttttatgaaaa |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
32211571 |
acaatatttttggtattatcttcaaattttagtcgtaggtatatatagataggtataggtacttagggctatacgtatgataaaaggatttttatgaaaa |
32211472 |
T |
|
| Q |
101 |
tttactgtcactaaaagt |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32211471 |
tttactgtcactaaaagt |
32211454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 305 - 404
Target Start/End: Complemental strand, 32211175 - 32211076
Alignment:
| Q |
305 |
gtatatttgagcctaaaatgtatgcaccggcaaaacaacacaaaacagaacaatgtttacataatagaaatatcctatgattaatattaaagtggtgatt |
404 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32211175 |
gtatatttgagcctaaaatatatgcatcggcaaaacaacataaaacagaacaacatttacataatagaaatgtcctatgattaatattaaagtggtgatt |
32211076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 97 - 180
Target Start/End: Complemental strand, 32211400 - 32211317
Alignment:
| Q |
97 |
aaaatttactgtcactaaaagtcaaatttctatgttcttcgagctatacctacgataaaagggtgtttacttactgatatttac |
180 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32211400 |
aaaatttgctgtcactaaaagccaaatttctacgttcttcgagctatacctacgataaaagggtgtttacttatagatatttac |
32211317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 98 - 128
Target Start/End: Complemental strand, 44105118 - 44105088
Alignment:
| Q |
98 |
aaatttactgtcactaaaagtcaaatttcta |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44105118 |
aaatttactgtcactaaaagtcaaatttcta |
44105088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University