View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14497_high_22 (Length: 233)
Name: NF14497_high_22
Description: NF14497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14497_high_22 |
 |  |
|
| [»] scaffold0008 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 6138933 - 6139148
Alignment:
| Q |
1 |
catcatttctatatccctctacagcaacaggtgcagcaagaggttcttcttctcgaagcacaagccggaggcagaataacaacaataacgtggacatctt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6138933 |
catcatttctatatccctctacaacaacaggtggagcaagaggttcttcttctcgaagcacaagccggaggcagaacaacaacaataacgtggacatctt |
6139032 |
T |
 |
| Q |
101 |
tgatcttattcatgaacaacgaatggatgaagcatatgctgaaaacatgataaatgttcaacaacatgcaaggttattgccaggaggccgtgtaaatcga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6139033 |
tgatcttattcatgaacaacgaatggatgaagcatatgctgaaaatatgataaatgttcaacaacatgcaaggttattgccaggaggccgtgtaaatcga |
6139132 |
T |
 |
| Q |
201 |
tttagtgttccaacta |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6139133 |
tttagtgttccaacta |
6139148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 33731333 - 33731270
Alignment:
| Q |
1 |
catcatttctatatccctctacagcaacaggtgcagcaagaggttcttcttctcgaagcacaag |
64 |
Q |
| |
|
|||||||||||||||||||| |||||||| | | ||||| | |||||||||||| | ||||||| |
|
|
| T |
33731333 |
catcatttctatatccctctgcagcaacaagagaagcaacaagttcttcttctcaaggcacaag |
33731270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 33802712 - 33802649
Alignment:
| Q |
1 |
catcatttctatatccctctacagcaacaggtgcagcaagaggttcttcttctcgaagcacaag |
64 |
Q |
| |
|
|||||||||||||||||||| |||||||| | | ||||| | |||||||||||| | ||||||| |
|
|
| T |
33802712 |
catcatttctatatccctctgcagcaacaagagaagcaacatgttcttcttctcaaggcacaag |
33802649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 8185 - 8138
Alignment:
| Q |
164 |
acatgcaaggttattgccaggaggccgtgtaaatcgatttagtgttcc |
211 |
Q |
| |
|
||||| ||||||||||| ||||||| |||| ||||||||||||||||| |
|
|
| T |
8185 |
acatgtaaggttattgcaaggaggctgtgtcaatcgatttagtgttcc |
8138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 18784 - 18737
Alignment:
| Q |
164 |
acatgcaaggttattgccaggaggccgtgtaaatcgatttagtgttcc |
211 |
Q |
| |
|
||||| ||||||||||| ||||||| |||| ||||||||||||||||| |
|
|
| T |
18784 |
acatgtaaggttattgcaaggaggctgtgtcaatcgatttagtgttcc |
18737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University