View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14497_low_11 (Length: 400)
Name: NF14497_low_11
Description: NF14497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14497_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 359; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 1 - 383
Target Start/End: Original strand, 11610071 - 11610453
Alignment:
| Q |
1 |
caacggttgatcataaacagatcacaacagccacaagaatggttctaaaccgaaatacatatgaaacatgcaatgctgaaaacaaaaacaacctaaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11610071 |
caacggttgatcataaacagatcacaacagccacaagaatggttctaaaccgaaatacatatgaaacatgcaatgctgaaaacaaaaacaacctaaaaca |
11610170 |
T |
 |
| Q |
101 |
ttttcatcttcattttcaacctttattttttctttgtcactgccaccactactactacctctagtagttgaacatggccactgttactacacaggcttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11610171 |
ttttcatcttcattttcaacctttattttttctttgtcactgccaccgctactactacctctagtagttgaacatggccactgttactacacaggcttca |
11610270 |
T |
 |
| Q |
201 |
gccgccattttccggccatgtggattgaaatcaaggttccttaccggttcttctggtaagttgaacagagaagtgtctattaggccaatggggtgttcac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11610271 |
gccgccattttccggccatgtggattgaaatcaaggttccttaccggttcttctggtaagttgaacagagaagtggctattaggccaatggggtgttcac |
11610370 |
T |
 |
| Q |
301 |
cttctgcttcttttaaggttgaagctaagaaaggagagtggttgcctggtttggcttccccaggttaccttactggcaggtat |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
11610371 |
cttctgcttcttttaaggttgaagctaagaaaggagagtggttacctggcttggcttctccaggttaccttactggcaggtat |
11610453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University