View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14497_low_17 (Length: 276)
Name: NF14497_low_17
Description: NF14497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14497_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 17 - 122
Target Start/End: Original strand, 30899284 - 30899389
Alignment:
| Q |
17 |
atttgtaaatgtagcagacccctttctgatttttactccacccgtgtttttagcatctaaaataatcgaaccctcataaatttttcgggatgatggtact |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
30899284 |
atttgtaaatgtagcagacccctttctgatttttactccacccgtgtttttagcatctaaaataatcgaaccctcataaatttttcggggtgatggtagt |
30899383 |
T |
|
| Q |
117 |
cactgt |
122 |
Q |
| |
|
|||||| |
|
|
| T |
30899384 |
cactgt |
30899389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 160 - 234
Target Start/End: Original strand, 30900028 - 30900102
Alignment:
| Q |
160 |
acataaagttatctgttgtttccattttcaaattcataacaaatgtccttaagtgccataaagacaattgttaac |
234 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
30900028 |
acataaagttatcagttgtttccattttcaaattcataacaagtgtccttaagtgccctaaagacaattgttaac |
30900102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University