View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14497_low_20 (Length: 246)
Name: NF14497_low_20
Description: NF14497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14497_low_20 |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 45769252 - 45769016
Alignment:
| Q |
1 |
ctcaaaaaataaattgttttttgactggcttaaaaataacgattggtgatcattaacctctccttttgtgttgtaaatttatctacttaattgtaggtcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45769252 |
ctcaaaaaataaattgttttttgactggcttaaaaataacgattggtgatcattaacctctccttttgtgttgtaaatttatctacttaattgtaggtcc |
45769153 |
T |
 |
| Q |
101 |
ctgaagaatatgagcaaccacatcatgtctatagtacaaaattcggtggatcttccatcctcaaggtacagtactattcttcccaattaattacttcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45769152 |
ctgaagaatatgagcaaccacatcatgtctatagtacaaaattcggtggatcttccatcctcaaggtacagtactattcttcccaattaattacttcaaa |
45769053 |
T |
 |
| Q |
201 |
ttatgatgcaaacatcttgaaatttatctaggaattc |
237 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45769052 |
ttatgatgcaaacatcttgaaatttgtctaggaattc |
45769016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 95 - 168
Target Start/End: Complemental strand, 40505 - 40432
Alignment:
| Q |
95 |
aggtccctgaagaatatgagcaaccacatcatgtctatagtacaaaattcggtggatcttccatcctcaaggta |
168 |
Q |
| |
|
|||| ||||| || |||||||| |||| || |||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
40505 |
aggttcctgatgattatgagcacccacttcgtgtctatagtacgaaatttgatggatcttccatcctcaaggta |
40432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University