View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14497_low_21 (Length: 239)
Name: NF14497_low_21
Description: NF14497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14497_low_21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 45769583 - 45769363
Alignment:
| Q |
19 |
actggttcgaggtcacattgtgagaaagaaaactgcagatatgctcaggcgtatgcaaacattggtgcgactacagacaaaggcacgtgcaagtcgtgcg |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45769583 |
actggttcgaggccacattgtgagaaagaaaactgcagatatgctcaggcgtatgcaaacattggtgcgactacagacaaaggcacgtgcaagtcgtgcg |
45769484 |
T |
 |
| Q |
119 |
cacttgtcatcagataatctgcattcttttaagtcttcactttctcattaccctgtaagtagcaaaatctatttttatgttctctctccccaatgagtta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45769483 |
cacttgtcatcagataatctgcattcttttaagtcttcactttctcattaccctgtaagtagcaaactctatttttatgttctctctccccaatgagtta |
45769384 |
T |
 |
| Q |
219 |
atgacacagacataattttgc |
239 |
Q |
| |
|
|||||||| || ||||||||| |
|
|
| T |
45769383 |
atgacacaaacgtaattttgc |
45769363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 27 - 177
Target Start/End: Complemental strand, 41572 - 41425
Alignment:
| Q |
27 |
gaggtcacattgtgagaaagaaaactgcagatatgctcaggcgtatgcaaacattggtgcgactacagacaaaggcacgtgcaagtcgtgcgcacttgtc |
126 |
Q |
| |
|
||||||||||||| |||||| | || || |||||||| || || |||||||||||||| ||||| ||| | |||||| |||||||||| |||| | || |
|
|
| T |
41572 |
gaggtcacattgtaagaaagcagacagctgatatgctaagacgaatgcaaacattggttcgacttcagtctcgggcacgcgcaagtcgtgtgcacatttc |
41473 |
T |
 |
| Q |
127 |
atcagataatctgcattcttttaagtcttcactttctcattaccctgtaag |
177 |
Q |
| |
|
|||||| |||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
41472 |
c---gataatatgcactctttcaagtcttcgctttctcattaccctgtaag |
41425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University