View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14497_low_24 (Length: 219)
Name: NF14497_low_24
Description: NF14497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14497_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 211
Target Start/End: Complemental strand, 22278314 - 22278120
Alignment:
| Q |
17 |
aggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggatcagggtgattgttgtattgtacgtctg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22278314 |
aggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggatcagggggattgttgtattgtacgtctg |
22278215 |
T |
|
| Q |
117 |
tggcgaggtacgaagtataaagtgggtgggtgaaggaggggagtctgggagggtcgagttggtggaaagatatcgtgaggattcgtgatgatgtc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22278214 |
tggcgaggtacgaagtataaagtgggtgggtgaaggaggggggtctgggagggtcgagttggtggaaggatatcgtgaggattcgtgatgatgtc |
22278120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 17 - 86
Target Start/End: Original strand, 51072127 - 51072196
Alignment:
| Q |
17 |
aggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtg |
86 |
Q |
| |
|
||||||||||| ||||||| ||| || | || |||||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
51072127 |
aggaaggaggtttgggggtcaggaggatgagggagtttaatgttgctctgttagggaaatggtgttggtg |
51072196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University