View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14497_low_25 (Length: 217)

Name: NF14497_low_25
Description: NF14497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14497_low_25
NF14497_low_25
[»] chr1 (1 HSPs)
chr1 (11-199)||(41734922-41735113)


Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 11 - 199
Target Start/End: Original strand, 41734922 - 41735113
Alignment:
11 aagcaaagggagaagagtgattattttcactaatagattttgcttcatcatattatgatcagtggcagattgaattggtgatgtcaagatggatggtaaa 110  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41734922 aagccaagggagaagagtgattattttcactaatagattttgcttcatcatattatgatcagtggcagattgaattggtgatgtcaagatggatggtaaa 41735021  T
111 agtgtataaatactctaccaaggttggcatatggtagattaccaatctg---attaggccaactatatattgaattggtgtgaagaatatat 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||    
41735022 agtgtataaatactctaccaaggttggcatatggtagattaccaatctgatcattaggccaactatatattgaattggtgtgaagaatatat 41735113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University