View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14497_low_25 (Length: 217)
Name: NF14497_low_25
Description: NF14497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14497_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 11 - 199
Target Start/End: Original strand, 41734922 - 41735113
Alignment:
| Q |
11 |
aagcaaagggagaagagtgattattttcactaatagattttgcttcatcatattatgatcagtggcagattgaattggtgatgtcaagatggatggtaaa |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41734922 |
aagccaagggagaagagtgattattttcactaatagattttgcttcatcatattatgatcagtggcagattgaattggtgatgtcaagatggatggtaaa |
41735021 |
T |
 |
| Q |
111 |
agtgtataaatactctaccaaggttggcatatggtagattaccaatctg---attaggccaactatatattgaattggtgtgaagaatatat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735022 |
agtgtataaatactctaccaaggttggcatatggtagattaccaatctgatcattaggccaactatatattgaattggtgtgaagaatatat |
41735113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University