View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14498_high_2 (Length: 251)
Name: NF14498_high_2
Description: NF14498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14498_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 8 - 235
Target Start/End: Original strand, 38927511 - 38927738
Alignment:
| Q |
8 |
gaaaagaggtctctgaactgtgcttccaatatttccactttcattcatgagatgaaaatgtgaaagtaacatgtttgcacgttcaaattgttgacaacct |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38927511 |
gaaaagaagtctctgaactgtgcttccaatatttccactttcattcatgagatgaaaatgtgaaagtaacatgtttgcacgttcaaattgttgacaacct |
38927610 |
T |
 |
| Q |
108 |
actctctcagctgctgctagaacaaactgagctagttcaacttgtttattttcttcctccgacaacaagcttccaagaacagttccataaggaatgtaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38927611 |
actctctcagctgctgctagaacaaactgagctagttcaacttgtttattttcttcctccgacaacaagcttccaagaacagttccataaggaatgtaaa |
38927710 |
T |
 |
| Q |
208 |
gattattatcatgccactgtgatgagtt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38927711 |
gattattatcatgccactgtgatgagtt |
38927738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University