View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14499_high_4 (Length: 234)
Name: NF14499_high_4
Description: NF14499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14499_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 6 - 218
Target Start/End: Original strand, 23415499 - 23415711
Alignment:
| Q |
6 |
atctttaccttttagggaaagagaataatgatattaattgggatgataaggtatttgggtatgttatggaacgtagcacatggtatgagcttgaaagagt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23415499 |
atctttaccttttagggaaagagaataatgatattaattgggatgataaggtatttgggtatgttatggaacgtagcacatggtatgagcttgaaagagt |
23415598 |
T |
 |
| Q |
106 |
gcnnnnnnncatggggccaacctgtgtgatttttatggtcacatcttagcagcactattgctcatcatccacctcttataatcctttaaaggaaaaggtt |
205 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23415599 |
gcaaaaaaacatggggccaacctgtgtgatttttatggtcacatcttagcagcactattgctcatcatccacctcttataatcctttaaaggtaaaggtt |
23415698 |
T |
 |
| Q |
206 |
aataaatttgttt |
218 |
Q |
| |
|
||||||||||||| |
|
|
| T |
23415699 |
aataaatttgttt |
23415711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University